added skeletons for starting the tutorial

66d3f70f · Thomas Schwarzl · 8f034832 · 66d3f70f · 66d3f70f · 66d3f70f
Commit 66d3f70f authored Feb 03, 2016 by Thomas Schwarzl
Hide whitespace changes
Inline Side-by-side

Showing with 20 additions and 0 deletions

00-start/A.fasta 00-start/A.fasta +2 -0

00-start/B.fasta 00-start/B.fasta +2 -0

00-start/Snakefile 00-start/Snakefile +16 -0

No files found.
--- a/00-start/A.fasta
+++ b/00-start/A.fasta
+>A
+ACATATAGAGATATAT
--- a/00-start/B.fasta
+++ b/00-start/B.fasta
+>B
+ACACAATCTATCATCTACTACGACGAGCGACGAGCGACGGACGAGGGTATCTATCTAGCAGC
--- a/00-start/Snakefile
+++ b/00-start/Snakefile
+rule summarize:
+	input:
+		#TODO
+	output:
+		#TODO
+	shell:
+		"wc -c #TODO"
+
+rule extract:
+	input:
+		#TODO
+	output:
+		#TODO
+	shell:
+		"cut -f7 -d ' ' #TODO"
+