B.fasta 66 Bytes
Newer Older
Thomas Schwarzl's avatar
Thomas Schwarzl committed
1 2
>B
ACACAATCTATCATCTACTACGACGAGCGACGAGCGACGGACGAGGGTATCTATCTAGCAGC