B.fasta 66 Bytes
Newer Older
1 2
>B
ACACAATCTATCATCTACTACGACGAGCGACGAGCGACGGACGAGGGTATCTATCTAGCAGC