Commit 7c53db8f authored by Thomas Schwarzl's avatar Thomas Schwarzl

init

parents
>A
ACATATAGAGATATAT
>B
ACACAATCTATCATCTACTACGACGAGCGACGAGCGACGGACGAGGGTATCTATCTAGCAGC
rule all:
input:
"extract.txt"
rule summarize:
input:
"A.fasta",
"B.fasta"
output:
"sum.txt"
shell:
"wc -c {input} > {output}"
rule extract:
input:
"sum.txt"
output:
"extract.txt"
shell:
"cut -f7 -d ' ' {input} > {output}"
rule clean:
shell:
"rm extract.txt sum.txt"
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment