example_sequences2.fasta 445 Bytes
Newer Older
1
2
3
4
5
6
7
8
9
10
11
12
>sequence_1
ATCGATTGATCGCCCATAAATCGTTTCCCCCTAGCAGTAACCTCGCTCAGCCTTAAGCC
>sequence_2
ACGACGACGACGACGACGACGACGACGACGACGACGACG
>sequence_3
AGTCGATAAGATCGCTCCMATCGATAACAHCACTAGCDKAGCTAGCTA
>sequence_4
AGTCGATCCGATCCGAATAGCTCGATCGCCTAGCTAAGCTAGCTAGCTAGGATCGCTAGT
GTCGATAAGTCTCCGCTCTCATTATAAGTCTCCGATAATCTCGATATCGTTTACGCTTCG
GTACAGCGACAAAGTCCCTAGATAACTAGATACTTTAGCTAGATCTAGATCTGACAGTCG
>sequence_5
agctagatagctccgatcgaatcgatcgctcgatcgatccgatcgatatcgat