Commit c833ac46 authored by Toby Hodges's avatar Toby Hodges
Browse files

added example sequence files

parent 5584b80f
>sequence_1
ATCGATTGATCGCCCATAAATCGTTTCCCCCTAGCAGTAACCTCGCTCAGCCTTAAGCC
>sequence_2
GTCCATGATCCGCTAGAACAGATCGATAGACAGATCGCATAG
>sequence_3
CTCACTAGACATCCCTAGATACAACACGTAGACAGGTTTTACCTAGACAAAAC
>sequence_4
GTCCGATACAGATCGACAGATCGACAGATCGACAAGTCTCGCTAGACAAGCCCTCAAACC
>sequence_5
TTATAGAAACAATAGAACATAGACAATAGACAATATAGACAACCCAAATATAA
>sequence_1
ATCGATTGATCGCCCATAAATCGTTTCCCCCTAGCAGTAACCTCGCTCAGCCTTAAGCC
>sequence_2
ACGACGACGACGACGACGACGACGACGACGACGACGACG
>sequence_3
AGTCGATAAGATCGCTCCMATCGATAACAHCACTAGCDKAGCTAGCTA
>sequence_4
AGTCGATCCGATCCGAATAGCTCGATCGCCTAGCTAAGCTAGCTAGCTAGGATCGCTAGT
GTCGATAAGTCTCCGCTCTCATTATAAGTCTCCGATAATCTCGATATCGTTTACGCTTCG
GTACAGCGACAAAGTCCCTAGATAACTAGATACTTTAGCTAGATCTAGATCTGACAGTCG
>sequence_5
agctagatagctccgatcgaatcgatcgctcgatcgatccgatcgatatcgat
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment